Phân lập và tuyển chọn chủng nấm men phù hợp ứng dụng trong sản xuất rượu dõng Whisky từ ngô và Malt đại mạch

pdf 8 trang Hùng Dũng 04/01/2024 230
Bạn đang xem tài liệu "Phân lập và tuyển chọn chủng nấm men phù hợp ứng dụng trong sản xuất rượu dõng Whisky từ ngô và Malt đại mạch", để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên

Tài liệu đính kèm:

  • pdfphan_lap_va_tuyen_chon_chung_nam_men_phu_hop_ung_dung_trong.pdf

Nội dung text: Phân lập và tuyển chọn chủng nấm men phù hợp ứng dụng trong sản xuất rượu dõng Whisky từ ngô và Malt đại mạch

  1. JOURNAL OF SCIENCE OF HNUE DOI: 10.18173/2354-1059.2016-0019 Natural Sci. 2016, Vol. 61, No. 4, pp. 122-129 This paper is available online at PHÂN LẬP VÀ TUYỂN CHỌN CHỦNG NẤM MEN PHÙ HỢP ỨNG DỤNG TRONG SẢN XUẤT RƢỢU DÕNG WHISKY TỪ NGÔ VÀ MALT ĐẠI MẠCH Nguyễn Văn Quyên1, Nguyễn Quang Thảo2 và Nguyễn Thành Đạt1 1Khoa Sinh học, Trường Đại học Sư phạm Hà Nội 2Vụ Khoa học và Công nghệ, Bộ Công Thương Tóm tắt: Nấm men có ảnh hƣởng lớn tới hƣơng, vị và chất lƣợng rƣợu. Việc tuyển chọn Ďƣợc chủng nấm men phù hợp với nguyên liệu và chất lƣợng Ďặc trƣng của sản phẩm luôn là một trong những yếu tố chính quyết Ďịnh sự thành công của công nghệ. Trong phạm vi bài viết, chúng tôi Ďề cập tới nội dung phân lập và tuyển chọn chủng nấm men từ các nguồn bánh men truyền thống Ďể ứng dụng trong lên men rƣợu cao Ďộ từ nguyên liệu là ngô và malt Ďại mạch. Các chủng nấm men Ďƣợc phân lập và lên men trên hai loại môi trƣờng ngô và malt Ďại mạch ở 250C, thời gian lên men: 10 ngày. Kết thúc lên men tiến hành chƣng cất thu hồi sản phẩm và Ďánh giá cảm quan theo TCVN 3215-79, kết hợp phân tích sắc kí khí Ďể xác Ďịnh thành phần, Ďịnh lƣợng tạp chất, chất tạo hƣơng, vị, chúng tôi thu Ďƣợc kết quả: Từ 107 dòng tế bào nấm men phân lập từ bánh men truyền thống (Bắc Hà, Mẫu Sơn, làng Vân) Ďã chọn Ďƣợc chủng nấm men (kí hiệu MS42) Ďạt Ďiểm cảm quan 16,6/20; hiệu suất lên men Ďạt 89,45%, thành phần tạp chất (metanol (không phát hiện < 0,50 mg/L), Acetandehide (125mg/L), rƣợu bậc cao (216mg/L), furfufol (không phát hiện < 0,21 mg/L) Ďạt tiêu chuẩn Việt Nam. Từ khóa: Nấm men, phân lập, lên men, ngô, malt Ďại mạch, cảm quan, TCVN 3215-79. 1. Mở đầu Trong công nghệ sản xuất rƣợu ngƣời ta thƣờng dùng những chủng nấm men thuộc giống Saccharomyces cerevisiae, tùy theo chất lƣợng của từng loại nguyên liệu và yêu cầu chất lƣợng từng loại rƣợu mà các chuyên gia công nghệ và các nhà sản xuất quyết Ďịnh chọn chủng nấm men nào thuộc Saccharomyces cerevisiae. Chính việc chọn và sử dụng chủng nấm men trên Ďã tạo nên hàng trăm loại sản phẩm rƣợu cao Ďộ có chất lƣợng khác nhau từ các loại nguyên liệu khác nhau, thậm chí cũng rất khác nhau về cảm quan ngay khi cùng sử dụng một loại nguyên liệu nhƣ nhau, trong Ďó nổi bật là các loại rƣợu thuộc các dòng: Whisky, Brandy, vodka, Cognac, Mao Ďài, Sake, Nếp cái hoa vàng, chính việc sử dụng Ďộc quyền về chủng nấm men Ďặc trƣng Ďã làm nên thƣơng hiệu của các sản phẩm rƣợu nổi tiếng thế giới [1]. Việc nghiên cứu tuyển chọn chủng nấm men phù hợp cho sản xuất rƣợu cao Ďộ từ ngô và malt Ďại mạch phù hợp Ďiều kiện sản xuất của Việt Nam sẽ mang lại nhiều lợi ích kinh tế lớn, tạo ra Ďƣợc sản phẩm có chất lƣợng cao, an toàn, phù hợp với nhu cầu thị trƣờng trong nƣớc, từng bƣớc hƣớng ra thị trƣờng xuất khẩu thế giới. 2. Nội dung nghiên cứu 2.1. Nguyên liệu và phƣơng pháp nghiên cứu 2.1.1. Nguyên liệu, thiết bị và hóa chất - Chủng nấm men: Phân lập từ các nguồn bánh men truyền thống ở các Ďịa phƣơng: Mẫu sơn (tỉnh Lạng Sơn), Làng Vân (tỉnh Bắc Giang) và Băc Hà (tỉnh Lào Cai). - Malt: Nhập khẩu từ Barley (Sebastian, Pháp). Ngày nhận bài: 2/1/2016. Ngày nhận Ďăng: 22/3/2016. Tác giả liên lạc: Nguyễn Văn Quyên, Ďịa chỉ e-mail: vanquyengv@gmail.com 122
  2. Phân lập và tuyển chọn chủng nấm men phù hợp ứng trong sản xuất rượu dòng Whisky từ ngô và Malt đại mạch - Ngô hạt: Giống ngô DK9955 của công ti Dekalb, trồng phổ biến tại Việt Nam - Môi trƣờng tuyển chọn nấm men gồm: Môi trƣờng 100% malt (kí hiệu: M) có tỉ lệ malt:nƣớc = 1:4,2; Môi trƣờng 100% ngô (kí hiệu: N) có tỉ lệ ngô:nƣớc = 1:4,0 có thành phần cơ bản sau: Kí hiệu Brix Đƣờng khử (g/L) Protein (g/L) FAN (mg/L) pH M 18 170,55 9,21 204,5 5,4 N 18 169,30 4,23 68,5 5,6 Brix: Biểu thị tỉ lệ % khối lượng các chất hoà tan so với khối lượng dung dịch đường; FAN: Hàm lượng axit amin tự do - Hóa chất: Các hoá chất tinh khiết, Ďƣờng glucoza, pepton, caomen, aga (của Merck, Mỹ); Các loại muối: NaCl, KH2PO4, (NH4)2SO4, MgSO4.7H2O (hóa chất phân tích loại PA) Enzym Termamyl®; Dextrozyme ® GA (Novozymes - Đan Mạch) - Thiết bị: Tủ ổn nhiệt FOC - 225E, Kính hiển vi Ďiện tử Olympus BX – 41, Máy sắc kí khí GC System HP 6890 series, Bộ trƣng cất cồn SMICO, Nồi hấp, Máy Ďo Ďộ cồn, Ďộ Ďƣờng, 2.1.2. Phƣơng pháp nghiên cứu - Phân lập nấm men: Trên môi trƣờng Hanxen có bổ sung cloramphenicol 0,2 g/L [2]. - Đánh giá khả năng tạo hƣơng, vị Ďặc trƣng: Theo tiêu chuẩn và Ďiểm cảm quan theo thang 20 (TCVN 3215 - 79) kết hợp phân tích sắc kí khí xác Ďịnh Ďịnh tính, Ďịnh lƣợng các chất thu Ďƣợc trong sản phẩm. - Đếm số lƣợng tế bào theo buồng Ďếm Thorma - Tính giá trị Ďƣờng trong dịch theo phƣơng pháp DNS ứng với Ďƣờng mantose và Ďƣờng glucose, kết hợp so sánh Ďối chứng với phƣơng pháp Bectran [3]. - Xử lí số liệu, dựng Ďồ thị Ďƣờng chuẩn trên Excel, sắc kí Ďồ. - Giải trình tự gen chủng MS42: Theo kĩ thuật [4, 5]; giải trình tự rADN của chủng MS42 [6, 7] và Ďọc bằng phƣơng pháp “dideoxy chain termination” với kit AmpliTaq (Amersham) trên máy model 377 (của hãng Applied Biosystem) và Ďối chiếu với GeneBank tại National Center for Biotechnology Information, Bethesda (Mỹ). Các chuỗi liên quan Ďƣợc chuyển tải về sau Ďó xử lí bằng phần mềm BioEdit (Hall, 1999) [4, 5]. PCR trên gel agarose 1% trong Ďệm TAE 0.5 × M: ADN thang chuẩn 1 Kb (Thermo scientific), ITS1-NL4: sản phẩm PCR từ ADN tổng số của mẫu MS42 với cặp mồi ITS1-NL4. Khảo sát trình tự vùng gen ITS1, ITS2 của 5,8S và D1, D2 của 28S. Hình 1. Sơ đồ vùng ITS1, ITS2 của 5,8S và D1,D2 của 28S 2.2. Kết quả nghiên cứu 2.2.1. Phân lập nấm men Nguồn nấm men sử dụng Ďể phân lập từ 03 loại bánh men thu Ďƣợc tại Mẫu sơn, Làng Vân và Băc Hà, trong Ďó: Bánh men Bắc Hà và bánh men Mẫu Sơn chủ yếu dùng Ďể sản xuất rƣợu từ ngô theo phƣơng pháp cổ truyền thống, bánh men làng Vân Ďể lên men rƣợu từ gạo và sắn (Hình 2). a. Bánh men Bắc Hà b. Bánh men Mẫu Sơn c. Bánh men Làng Vân Hình 2. Bánh men truyền thống 123
  3. Nguyễn Văn Quyên, Nguyễn Quang Thảo và Nguyễn Thành Đạt Các mẫu bánh men truyền thống Ďƣợc nghiền nhỏ và lên men trong môi trƣờng Hanxen lỏng, có bổ sung cloramphenicol 0,2 g/L, thời gian t = 24 giờ. Sau 24 giờ tiến hành thu và pha loãng chế dịch lên men theo các nồng Ďộ: 105 - 106 - 107 - 108. Tiến hành cấy trên môi trƣờng Hanxen rắn (trên thạch Ďĩa), thời gian nuôi cấy là 3 ngày, quan sát Ďặc Ďiểm từng khuẩn lạc về: kích thƣớc, hình dạng, mầu sắc, Ďặc Ďiểm bề mặt, Ďặc Ďiểm rìa khuẩn lạc, Ďể chọn chủng nấm men phù hợp. - Kết quả: Từ 03 nguồn bánh men khác nhâu, Ďã phân lập Ďƣợc 107 chủng nấm men, trong Ďó có 42 chủng (kí hiệu từ BH1 Ďến BH42) từ bánh men Bắc Hà (BH); 43 chủng (kí hiệu từ MS1 Ďến MS43) từ bánh men Mẫu Sơn (MS) và 22 chủng (kí hiệu từ LV1 Ďến LV22) từ bánh men Làng Vân. 2.2.2 Chọn chủng nấm men phù hợp Chủng nấm men lựa chọn cần Ďạt một số yêu cầu sau: - Sinh trƣởng tốt trong dịch malt và ngô; - Có khả năng lên men tạo Ďộ cồn cao và Ďạt hiệu suất lên men cao; - Tạo hƣơng thơm, vị Ďặc trƣng của sản phẩm, ít Ďộc tố [1, 8, 9]. Từ các loại bánh men thu thập Ďƣợc tại các Ďịa phƣơng (nêu trên), chúng tôi Ďã phân lập Ďƣợc 107 chủng nấm men, tiến hành lên men các chủng phân lập Ďƣợc trên môi trƣờng M và N ở Ďiều kiện: Nhiệt Ďộ lên men: 25 0C, sau 10 ngày lên men, thu hồi và chƣng cất lần 1 Ďể thu hồi toàn bộ rƣợu và chất thơm có trong dịch lên men Ďể tiến hành Ďánh giá cảm quan và phân tích thành phần các chất thơm, Ďộc tố có trong rƣợu lên men. Tiến hành chƣng cất 02 lần, lần thứ nhất chƣng cất và thu hồi toàn bộ rƣợu và các chất thơm có trong rƣợu lên men Ďể xác Ďịnh hàm lƣợng rƣợu và các chất thơm cũng nhƣ rƣợu Ďộc (Methanol). Chƣng cất lần 2, tách bỏ 5% rƣợu Ďầu và 15% rƣợu cuối, rƣợu sản phẩm thu Ďƣợc có nồng Ďộ 400V. Tiến hành Ďánh giá cảm quan theo phƣơng pháp cho Ďiểm theo thang 20 (TCVN 3215-79) và phân tích sắc kí khí các thành phần tạp chất metanol, acetandehide, Fucfurol, rƣợu bậc cao (propanol, iso/n-butanol, iso/n-pentanol) [3, 10], chúng tôi Ďã chọn Ďƣợc 15 chủng có Ďánh giá cảm quan tốt. Kết quả thu Ďƣợc ở Bảng 1 và Bảng 2. Bảng 1. Kết quả phân tích và đánh giá cảm quan của 15 chủng nấm men (trên môi trường M) Đánh giá cảm quan (TCVN 3215-79) Hiệu Chủng Đƣờng Cồn sau Độ Đƣờng sót suất lên Stt nấm khử lên men trong Hệ (g/L) men Hệ số Hệ số Tổng men (g/L) (% v/v) và số Mùi Vị rƣợu (1,2) (2,0) điểm màu (0,8) sắc 1 LV4 170,6 2,08± 0,1 8,50 78,40 3,6 0,8 3,9 1,2 3,7 2 15,0 2 LV22 170,6 3,26± 0,2 9,20 85,45 4,6 0,8 4,2 1,2 3,8 2 16,3 3 MS18 170,6 3,24± 0,2 9,20 85,44 4,5 0,8 4,3 1,2 3,7 2 16,3 4 MS40 170,6 3,01± 0,2 9,50 88,11 4,5 0,8 4,1 1,2 3,8 2 16,1 5 MS42 170,6 2,05± 0,2 9,70 89,45 4,5 0,8 4,3 1,2 3,9 2 16,6 6 BH1 170,6 3,24± 0,2 9,00 83,58 4,3 0,8 3,1 1,2 3,9 2 15,0 7 BH2 170,6 2,95± 0,1 9,00 83,44 4,6 0,8 3,9 1,2 3,7 2 15,8 8 BH19 170,6 3,25± 0,2 9,50 88,23 4,5 0,8 3.9 1,2 3,9 2 16,1 9 BH20 170,6 2,16± 0,1 8,80 81,20 4,1 0,8 3,1 1,2 4,2 2 15,4 10 BH24 170,6 5,23± 0,2 9,20 86,47 3,5 0,8 4,1 1,2 3,9 2 15,5 11 BH30 170,6 5,62± 0,2 9,00 84,79 4,6 0,8 4,1 1,2 3,8 2 16,2 12 BH33 170,6 3,01± 0,2 9,50 88,11 4,2 0,8 3,4 1,2 4,2 2 15,8 13 BH34 170,6 5,28± 0,2 9,00 84,62 4,1 0,8 3,2 1,2 4,1 2 15,3 14 BH41 170,6 5,28± 0,3 8,50 79,91 3,9 0,8 3,1 1,2 4,3 2 15,4 15 BH42 170,6 2,95± 0,2 9,20 85,29 4,2 0,8 3,8 1,2 3,6 2 15,1 124
  4. Phân lập và tuyển chọn chủng nấm men phù hợp ứng trong sản xuất rượu dòng Whisky từ ngô và Malt đại mạch Kết quả trên cho thấy: Trên môi trƣờng dịch 100% malt, chủng MS42 Ďạt Ďiểm cao nhất là 16,6 Ďiểm, tiếp Ďến là các chủng LV22 ) Ďạt 16,3 Ďiểm) và chủng BH30 (Ďạt 16,2 Ďiểm). Bảng 2. Kết quả phân tích và đánh giá cảm quan của 15 chủng nấm men (trên môi trường N) Đánh giá cảm quan (TCVN 3215-79) Hiệu Chủng Đƣờng Cồn sau suất Độ Đƣờng Stt nấm khử lên men lên trong sót (g/L) Hệ số Hệ số Hệ số Tổng men (g/L) (% v/v) men và Mùi Vị (0,8) (1,2) (2,0) điểm rƣợu màu sắc 1 LV4 169,3 2,58± 0,2 8,50 79,22 4,5 0,8 4,1 1,2 3,2 2 14,9 2 LV22 169,3 3,26± 0,2 9,00 84,22 4,5 0,8 3,9 1,2 3,5 2 15,3 3 MS18 169,3 3,28± 0,2 9,20 86,10 4,5 0,8 4,1 1,2 3,2 2 14,9 4 MS40 169,3 3,05± 0,2 9,40 87,85 4,5 0,8 4,1 1,2 3,2 2 14,9 5 MS42 169,3 2,16± 0,1 9,50 88,32 4,8 0,8 4,2 1,2 3,5 2 15,9 6 BH1 169,3 3,64± 0,2 8,70 81,60 4,2 0,8 4,2 1,2 3,2 2 14,8 7 BH2 169,3 2,15± 0,1 9,00 83,66 4,2 0,8 4,1 1,2 3,1 2 14,5 8 BH19 169,3 3,65± 0,2 9,00 84,42 4,1 0,8 4,0 1,2 3,5 2 15,1 9 BH20 169,3 2,56± 0,2 8,50 79,21 3,6 0,8 4,3 1,2 3,1 2 14,2 10 BH24 169,3 5,63± 0,3 8,50 80,70 3,2 0,8 4,1 1,2 3,6 2 14,7 11 BH30 169,3 4,02± 0,2 9,00 84,61 4,5 0,8 4,1 1,2 3,5 2 15,5 12 BH33 169,3 3,41± 0,2 9,30 87,11 3,9 0,8 4,2 1,2 3,2 2 14,6 13 BH34 169,3 3,28± 0,2 9,00 84,23 4,2 0,8 4,1 1,2 3,2 2 14,7 14 BH41 169,3 5,68± 0,3 8,50 80,72 3,9 0,8 4,1 1,2 3,5 2 15,0 15 BH42 169,3 3,05± 0,2 9,00 84,12 4,3 0,8 3,8 1,2 3,2 2 14,4 Trên môi trƣờng dịch 100% ngô, chủng MS42 Ďạt Ďiểm cao nhất là 15,9 Ďiểm, tiếp Ďến là các chủng BH30 (Ďạt 15,5 Ďiểm) và chủng LV22 (Ďạt 15,3 Ďiểm). Trong 15 chủng trên thì 03 chủng MS42, BH30 và LV22 Ďều Ďạt các chỉ tiêu và Ďạt Ďiểm cao ở cả 2 môi trƣờng M và N, trong Ďó chủng MS42 Ďạt Ďiểm cao nhất ở cả 2 môi trƣờng M và N. Kết quả cảm quan cũng trùng lặp với kết quả phân tích sắc kí khí các chất thơm và Ďộc tố có trong thành phần rƣợu của 3 chủng tại Bảng 3 và Bảng 4. Bảng 3. Kết quả phân tích sắc kí khí rượu từ dịch malt sau chưng cất Chủng Acetaldehyde Ancol bậc cao Stt nấm Metanol (mg/L) Fucfurol (mg/L) (mg/L) (mg/L) men 1 LV22 KPH (˂0,5) 35 ± 1 218 ± 2 KPH (˂0,21) 2 MS42 KPH (˂0,5) 39 ± 1 183 ± 2 KPH (˂0,21) 3 BH30 KPH (˂0,5) 91 ± 1 252 ± 2 KPH (˂0,21) KPH: không phát hiện 125
  5. Nguyễn Văn Quyên, Nguyễn Quang Thảo và Nguyễn Thành Đạt Bảng 4. Kết quả phân tích sắc kí khí rượu từ dịch ngô sau chưng cất Chủng Acetaldehyde Ancol bậc cao Stt nấm Metanol (mg/L) Fucfurol (mg/L) (mg/L) (mg/L) men 1 LV22 KPH (˂0,5) 131 ± 2 229 ± 1 0,26 ± 0,01 2 MS42 KPH (˂0,5) 125 ± 2 216 ± 1 KPH (˂0,21) 3 BH30 KPH (˂0,5) 127 ± 1 232 ± 2 KPH (˂0,21) KPH: không phát hiện uV(x10,000) uV(x10,000) 3.5 3.5Chromatogram Chromatogram 3.0 3.0 2.5 2.5 2.0 2.0 n butanol/13.499/501567/15911 n n butanol/13.505/438330/14211 n 1.5 1.5 ald/5.330/34661/10987 1.0 1.0 iso amyl/15.489/117577/4427 iso iso amyl/15.474/105270/4217 iso iso butyl/11.177/17467/4171 iso ald/5.331/13561/3952 0.5 0.5 butyl/11.182/10791/2419 iso 0.0 0.0 5.0 7.5 10.0 12.5 15.0 min 2.5 5.0 7.5 10.0 12.5 15.0 17.5 min Hình 3. Sắc kí đồ sản phẩm rượu chưng cất Hình 4. Sắc kí đồ sản phẩm rượu chưng cất lần 1 của MS42 trên môi trường malt (M) lần 1 của MS42 trên môi trường ngô (N) Từ các kết quả thu Ďƣợc chúng tôi Ďã sử dụng 3 chủng MS42, BH30 và LV22 Ďể tiến hành các nghiên cứu tiếp theo Ďể chọn Ďƣợc chủng phù hợp. 2.2.3. Đánh giá khả năng lên men tạo độ cồn cao Tiến hành lên men 3 chủng trên môi trƣờng malt: ngô theo tỉ lệ (1:1) có bổ sung Ďƣờng saccharose Ďạt mức 200g/L. Tiến hành lên men ở 25 0C, thời gian lên men 10 ngày. Kết quả thu Ďƣợc (Bảng 5). Bảng 5. Khả năng lên men tạo cồn cao của 3 chủng Mẫu mấm Đƣờng khử Đƣờng sót Cồn sau chƣng Hiệu suất lên Stt men (g/L) (g/L) cất (% v/v) men rƣợu 1 LV22 220 10,79 11,8 87,64 2 MS42 220 8,25 12,2 89,52 3 BH30 220 9,79 12,0 88,70 * Nhận xét: Từ kết quả các thí nghiệm (nêu trên) cho thấy: Cả 3 chủng MS42, BH30, LV22 Ďều tạo ít Ďộc tố và tạp chất, hàm lƣợng metanol Ďều không phát hiện KPH (˂ 0,5). Chủng MS42 là chủng có ƣu Ďiểm: Tạo cồn Ďạt 12,2%V, hiệu suất lên men Ďạt 89,52%, tạo hƣơng thơm tốt nhất và ít Ďộc tố nhất trên cả hai môi trƣờng malt (M) và ngô (N) [1, 11]. Chủng MS42 Ďƣợc chúng tôi chọn Ďể tiến hành khảo sát các tiêu chí tiếp theo. 2.2.4. Nghiên cứu một số đặc điểm sinh học và định danh chủng MS42 * Đặc điểm hình thái của chủng nấm men MS42 Tiến hành nuôi cấy chủng MS42 trên môi trƣờng Hanxen lỏng, nuôi lắc 150 (vòng/phút). Sau thời gian nuôi cấy 12 giờ. Quan sát tế bào dƣới kính hiển vi (100 × 10) chúng tôi thấy chủng MS42 có tế bào hình hình cầu, kích thƣớc từ 3 - 4 m. Tế bào nấm men Ďồng Ďều và sinh sản bằng hình thức nảy chồi. Tỉ lệ tế bào nảy chồi ở giai Ďoạn 16 - 24 giờ rất cao Ďạt trên 70%, tỉ lệ tế bào chết nhỏ hơn 5% [6]. Đặc Ďiểm của khuẩn lạc sau 6 ngày nuôi trên môi trƣờng Hanxen: hình tròn, kích thƣớc từ 2 - 4 mm, màu trắng sữa, bề mặt bóng sáng, mép khuẩn lạc nhẵn, giữa khuẩn lạc lồi, không có vòng tròn Ďồng tâm, không có tia phóng xạ. 126
  6. Phân lập và tuyển chọn chủng nấm men phù hợp ứng trong sản xuất rượu dòng Whisky từ ngô và Malt đại mạch Khi cấy chủng MS42 trên môi trƣờng Hanxen Ďặc, nghèo dinh dƣỡng và khô hạn, sau 20  25 ngày nuôi cấy, chúng tôi tiến hành quan sát tế bào bằng kính hiển vi (100 × 10) có nhiều tế bào của MS42 Ďã hình thành bào tử, trong mỗi túi bào tử có 4 bào tử có hình cầu (hình cầu) không có màu, màng nhẵn. Kết quả thu Ďƣợc ở các Hình 5, 6 và 7. Hình 5. Khuẩn lạc chủng MS42 Hình 6. Hình dạng tế bào trên môi trường Hanxen chủng MS42 Hình 7. Hình thành túi bào tử của chủng MS42 * Khả năng lên men đường của chủng nấm men MS42 Tiến hành thí nghiệm lên men các loại Ďƣờng (D-glucoza, sacaroza, maltoza, galactoza, ranfinoza, 0 dextrin, lactoza) của chủng MS42 ở 25 - 30 C, quan sát khả năng tạo CO2 Ďể xác Ďịnh khả năng sử dụng Ďƣờng [11, 12]. Kết qủa thu Ďƣợc nhƣ sau (Bảng 7). Bảng 7. Khả năng lên men các loại đường của chủng nấm men MS42 Loại đƣờng Khả năng lên men Loại đƣờng Khả năng lên men D-Glucoza + + Sacaroza + + Maltoza ++ Galactoza + Rafinoza + Dextrin − Melibioza − Lactoza + Ghi chú: Khả năng lên men: Không lên men: -, Có lên men nhưng không mạnh: +, Lên men mạnh: ++. Chủng MS42 có khả năng lên men nhiều loại Ďƣờng khác nhau, trong Ďó lên men mạnh Ďƣờng glucoza, Maltoza và saccaroza nhƣng không lên men Dextrin và Melibioza. Kết quả các thí nghiệm trên cho thấy chủng MS42 mang các Ďặc Ďiểm sinh học Ďặc trƣng của nấm men Saccharomyces và phù hợp với những nghiên cứu trƣớc Ďó [11-13]. 127
  7. Nguyễn Văn Quyên, Nguyễn Quang Thảo và Nguyễn Thành Đạt * Giải trình tự gen chủng MS42 Giải trình tự gen Ďể Ďịnh danh chủng MS42, chúng tôi thu Ďƣợc kết quả sau: Hình 8. Kết quả kiểm tra điện di sản phẩm Bảng 8. Danh sách các mồi sử dụng trong phân loại Mồi Trình tự (5’ 3’) ITS1 TCCGTAGGTGAACCTGCGG NL4 CAGGAAACAGCTATGACGGTCCGTGTTTCAAGACGG Bảng 9. Kết quả so sánh trình tự vùng gen ITS1, ITS2 của 5,8S và D1, D2 của 28S Mẫu > MS42-ITS1 > MS42-NL4 > MS42-ITS1/LN4 (Full gene) So sánh trình tự ITS1, So sánh trình tự D1, D2 ITS2 của tiểu phần của tiểu phần 28S 5,8S rADN rADN Tên latinh Saccharomyces Saccharomyces Saccharomyces cerevisiae cerevisiae cerevisiae Trình tự tham chiếu CP006454.1 CP006454.1 CP006454.1 Tƣơng Ďồng 570/570 (100%) 768/768 (100%) 1330/1330 (100%) Hình 9. Kết quả xây dựng cây chủng loại phát sinh bằng phần mềm Mega 6 Kết quả phân tích trên cho thấy: Chủng MS42 thuộc chi nấm men Saccharomyces loài Saccharomyces cerevisiae. Chúng tôi Ďặt tên là Saccharomyces cerevisiae MS42. Vị trí phân loại của Saccharomyces cerevisiae: Lãnh giới: Eukaryota/Giới: Fungi/Ngành: Ascomycota/Ngành phụ: Ascomycetous Yeasts/Lớp: Ascomycetes/Bộ: Endomycetales/Họ: Saccharomycetaceae/Giống: Saccharomyces/Loài: Saccharomyces cerevisiae. 128
  8. Phân lập và tuyển chọn chủng nấm men phù hợp ứng trong sản xuất rượu dòng Whisky từ ngô và Malt đại mạch 3. Kết luận Từ các bánh men thu thập Ďƣợc ở các tỉnh Lạng Sơn, Bắc Giang và Lào Cai, chúng tôi Ďã phân lập Ďƣợc 107 chủng nấm men và chọn Ďƣợc 03 chủng nấm men (kí hiệu: MS42, BH30, LV22) có khả năng lên men tạo rƣợu có hƣơng, vị Ďặc trƣng và ít Ďộc tố, trong Ďó chủng MS42 thu Ďƣợc từ bánh men rƣợu Mẫu Sơn (Lạng Sơn) có khả năng lên men trên cả 02 loại môi trƣờng dịch malt và ngô, tạo Ďƣợc cồn và Ďạt hiệu suất lên men cao nhất, sản phẩm có hƣơng thơm và vị Ďặc trƣng tốt nhất, ít Ďộc tố nhất. Kết quả nghiên cứu một số Ďặc tính sinh học cơ bản của chủng nấm men MS42 kết hợp giải trình tự gen bằng kĩ thuật PCR Ďã xác Ďịnh chủng nấm men MS42 thuộc chi Saccharomyces loài Saccharomyces cerevisiae. Chủng MS42 Ďƣợc chúng tôi Ďặt tên là Saccharomyces cerevisiae MS42 và Ďƣợc chọn Ďể nghiên cứu sản xuất rƣợu Ďặc sản từ malt và ngô trong các nghiên cứu tiếp theo. TÀI LIỆU THAM KHẢO [1] Lƣơng Đức Phẩm, 2006. Nấm men công nghiệp. Nxb Khoa học Kỹ thuật (tr. 5-10, 29-35, 79- 91, 129-141). [2] Mai Thị Hằng, Đinh Thị Kim Nhung, Vƣơng Trọng Hào. 2011. Thực hành Vi sinh vật học. Nxb Đại học Sƣ phạm (tr. 35- 57, 61- 63, 77-82). [3] Lê Thanh Mai, Nguyễn Thị Hiền, Phạm Thu Thuỷ, Nguyễn Thanh Hƣơng, Lê Thị Lan Chi. 2006. Các phương pháp phân tích ngành công nghệ lên men. Nxb Khoa học Kỹ thuật (tr. 28, 42-51). [4] Sambrook J., Fritsch E. F., Maniatis T., 1989. Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, New York, pp. 102-115. [5] Thomas A. Hall, 1999. Bioedit: a user friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Oxford University Press, Nucleic acids symposium series No. 41, pp. 95-98. [6] Hibbett D. S, 1992. Ribosomal RNA and fungal systematic. Trans. Mycol. Soc. Jpn. (33) pp. 533-556. [7] Vilgalys R. and Hester M., 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Creptococcus species. Jour. Bac. 172 pp. 4238-4246. [8] Nguyễn Thành Đạt. 2005. Cơ sở sinh học vi sinh vật, tập 1. Nxb Đại học Sƣ phạm (tr. 28-42, 116, 197- 205, 233-240). [9] Nguyễn Thành Đạt. 2005. Cơ sở sinh học vi sinh vật, tập 2. Nxb Đại học Sƣ phạm (tr. 65- 68). [10] AOAC., 1984. Official Methods of Analysis. 14th Edition. (pp. 220-225). [11] Nguyễn Quang Thảo. 2000. Nghiên cứu lên men vang vải thiều. Luận án tiến sĩ Sinh học, Trƣờng Đại học Sƣ phạm Hà Nội (tr. 94-100). [12] Kreger van Rị. N. J. W. (Ed), 1984. The yeasts: a taxonomic study. 3rd, ed. Elseviver Science Publishers. Amsterdam, pp 112-128. [13] Lodder. J., 1971. The yeasts: a taxonomic study. 2rd, ed. North Holland. Pupl. Co. Amsterdam - London, pp. 76-92. ABSTRACT Isolated and selection of yeast fitness in wine production using specialty corn and barley malt Yeasts have a great influence on flavor, taste and product quality in wine production. The choice of yeast determines product quality in wine production. In this article, we isolate and select different yeasts from traditional yeast that result in a high alcohol using corn and barley malt. Different types of yeast were isolated and fermented from corn and barley malt at a temperature of 25 degree Celsius for 10 days. The end fermentation is evaluated using the 3215-79 Vietnamese standard combined with a gas chromatographic analysis to determine the composition and quantity of contaminants, flavorings, etc From 107 types of yeast isolated from traditional yeast (Bac Ha, Mau Son and Van Villages), we found MS42 yeast to have a sensory score of 16.6/20 and a fermentation performance of 89.45 percent. Those components meet Vietnam‟s impurity standards for methanol (< 0.50 mg/L), Acetaldehyde (125 mg/L), higher alcohol (propanol, iso/n-butanol, iso/n-pentanol) (216 mg/L) and furfufol (< 0.21 mg/L). Keywords: Yeast, isolated, fermentation, corn, barley malt, standard VN 3215-79. 129